Información

¿La ARN polimerasa se mueve alrededor del ADN o el ADN rota debajo de la polimerasa?


Estoy pensando en el genoma humano específicamente, pero las respuestas más generales son bienvenidas.

A medida que la ARN polimerasa se mueve a lo largo de la hélice de ADN, sigue una sola hebra. Las dos cadenas de ADN se desenrollan localmente mediante una enzima helicasa. Sin embargo, después de cierta distancia, imagino que la polimerasa debe moverse alrededor del eje del ADN O el ADN debe rotarse de alguna manera a lo largo de su longitud para aliviar la torsión de la polimerasa.

No puedo entender bien cómo el ADN puede rotar libremente, siendo parte de una molécula muy larga. Sin embargo, la otra opción también me está causando un problema: el ARNm en crecimiento (naciente) puede tener decenas de miles de bases mientras aún está unido a la ARN polimerasa y al molde de ADN. Si la ARN polimerasa sigue la hélice del ADN, ¿arrastra también consigo la transcripción completa?


Tanto el ADN como los complejos de ARN polimerasa se mueven a lo largo de la molécula de ADN como si fuera una pista. Si bien el nuevo ARNm es grande, nunca sería tan grande como todo el genoma, por lo que el punto de referencia es la molécula de ADN. Además, el funcionamiento del movimiento de estas enzimas es bastante similar al de otras proteínas que mueven polímeros largos "trepadores", como los polímeros de actina o los microtúbulos.

Uno de los modelos teóricos que describe el movimiento de este tipo de proteínas es el modelo de difusión térmica rectificada, basado en la idea de Richard Feynman del trinquete browniano. Un trinquete browniano es un dispositivo que permite la conversión de movimientos aleatorios brownianos en una fuerza direccional.

http://en.wikipedia.org/wiki/Brownian_ratchet

Las polimerasas consumen ATP, lo que les permite sufrir cambios conformacionales cíclicos (un cambio por ATP consumido), lo que permite que el complejo se adhiera a la molécula y se desprenda. Una vez que el complejo se ha desprendido, por simple difusión se mueve en una dirección aleatoria. Luego, vuelve a adherirse. Si el movimiento se ha producido en el sentido correcto, permanecerá donde terminó, mientras que si ha ido en el sentido incorrecto volverá a su posición anterior. Como solo se permiten unos pocos movimientos, el complejo solo se moverá en ese sentido, incluso si la fuerza motora es aleatoria.

No sé exactamente qué cambios conformacionales ocurren en la ARN polimerasa, pero este proceso general parece aplicarse a casi cualquier proteína móvil, incluidas aquellas enzimas que viajan a través de polímeros. Dado que la fuerza motora es difusión simple, y dado que la molécula de ARNm no necesita "viajar" con la polimerasa (simplemente flota unida a ella, pero no "tira"), creo que no hay ningún problema con esta.


La respuesta parcial de Miguel ayudó mucho pero necesitaba leer sobre la parte extra que me faltaba: Topoisomerasas.

El ADN se desenrolla debajo de la ARN polimerasa, lo que provoca un superenrollamiento por delante y por detrás. Para que prosigan las transcripciones largas, la teoría actual es que la plantilla de ADN debe cortarse, desenrollarse y volverse a ligar y que esto se realiza mediante topoisomerasas.

Esto plantea preguntas sobre la frecuencia con la que el ADN se corta y se vuelve a ligar durante la transcripción activa y ¿produce esto un efecto notable (es decir, mutación)?


Existe una visión alternativa de que las polimerasas son una especie de motores de ADN que mueven el ADN mientras ellas mismas permanecen estáticas. No puedo encontrar esa referencia ahora, pero leí esto ~ 5 años atrás en un artículo de Nature Reviews. La noción de transcripción y replicación. suerte también se adapta a este modelo.

Las regiones altamente transcritas tienen una mayor propensión a adquirir mutaciones [1].

Aunque no estoy seguro, la composición de la secuencia de genes también podría tener un papel. El tono de la hélice junto con otros parámetros físicos dependen de la composición de la secuencia. Se ha demostrado que las regiones genéticas tienen una composición diferente en comparación con las regiones no transcritas (las regiones genéticas tienen un mayor contenido de GC [2]).


Tendría que estar de acuerdo en que las "fábricas de transcripción" (varias ARN polimerasas y algunas otras proteínas combinadas) atraen el ADN y los factores de transcripción, y luego inician la transcripción mientras permanecen estáticos. En realidad, una de esas fábricas puede transcribir muchos genes a la vez. La mayoría de los libros y fuentes en línea todavía describen a la polimerasa como un movimiento a lo largo del ADN y realizando la transcripción, pero se ha demostrado que esto es incorrecto. fuente: http://www.ncbi.nlm.nih.gov/pubmed/8799830

Tampoco puedo encontrar el artículo sobre la naturaleza, pero también me enteré.


Replicación de ADN

En biología molecular, Replicación de ADN es el proceso biológico de producir dos réplicas idénticas de ADN a partir de una molécula de ADN original. [1] La replicación del ADN ocurre en todos los organismos vivos y actúa como la parte más esencial para la herencia biológica. Esto es esencial para la división celular durante el crecimiento y la reparación de tejidos dañados, mientras que también asegura que cada una de las nuevas células reciba su propia copia del ADN.. [2] La célula posee la propiedad distintiva de división, lo que hace que la replicación del ADN sea esencial.

El ADN está formado por una doble hélice de dos hebras complementarias. La doble hélice describe la aparición de un ADN de doble hebra que, por tanto, se compone de dos hebras lineales que corren opuestas entre sí y se retuercen juntas para formar. [3] Durante la replicación, estas hebras se separan. Cada hebra de la molécula de ADN original sirve luego como plantilla para la producción de su contraparte, un proceso denominado replicación semiconservadora. Como resultado de la replicación semiconservadora, la nueva hélice estará compuesta por una hebra de ADN original y una hebra recién sintetizada. [4] Los mecanismos celulares de corrección de pruebas y verificación de errores garantizan una fidelidad casi perfecta para la replicación del ADN. [5] [6]

En una célula, la replicación del ADN comienza en lugares específicos u orígenes de replicación en el genoma [7] que contiene el material genético de un organismo. [8] El desenrollado del ADN en el origen y la síntesis de nuevas hebras, acomodado por una enzima conocida como helicasa, da como resultado que las horquillas de replicación crezcan bidireccionalmente desde el origen. Varias proteínas están asociadas con la horquilla de replicación para ayudar en el inicio y continuación de la síntesis de ADN. De manera más prominente, la ADN polimerasa sintetiza las nuevas hebras agregando nucleótidos que complementan cada hebra (plantilla). La replicación del ADN ocurre durante la etapa S de la interfase.

También se puede realizar la replicación del ADN (amplificación del ADN) in vitro (artificialmente, fuera de una celda). Pueden usarse ADN polimerasas aisladas de células y cebadores de ADN artificiales para iniciar la síntesis de ADN en secuencias conocidas en una molécula de ADN molde. La reacción en cadena de la polimerasa (PCR), la reacción en cadena de la ligasa (LCR) y la amplificación mediada por transcripción (TMA) son ejemplos. En marzo de 2021, los investigadores informaron evidencia que sugería que una forma preliminar de transferencia de ARN, un componente necesario de la traducción, la síntesis biológica de nuevas proteínas de acuerdo con el código genético, podría haber sido una molécula replicadora en sí misma en el desarrollo temprano de la vida. o abiogénesis. [9] [10]


El cargador de pinza es un interruptor molecular operado por unión e hidrólisis de ATP

Los cargadores de pinza son miembros de la familia de ATPasas AAA + (ATPasas asociadas con diversas actividades celulares) [29] y se derivan de la misma raíz evolutiva que las helicasas y otros motores que trabajan en el ADN, muchos de los cuales también son ATPasas AAA +. El papel de las proteínas AAA + no se limita a los procesos dependientes del ADN, y apenas hay un aspecto de la función celular que no tenga una máquina AAA + jugando un papel importante. En arquitectura y mecanismo, las ATPasas AAA + están relacionadas de forma distante con las F1-ATPase [30], y al igual que con esa máquina transductora de energía, la evolución ha incorporado los sistemas AAA + al plan maestro de la vida. Berger y Erzberger [31] proporcionan una revisión completa de AAA + ATPasas, a la que se remite al lector para una discusión exhaustiva de estas ideas.

Inicialmente se pensó que era un motor [32-34], el cargador de pinza ahora se considera mejor como un dispositivo de sincronización o interruptor molecular [35], relacionado conceptualmente y en mecanismo molecular con pequeñas GTPasas como Ras [36]. El cargador de la pinza debe estar unido a ATP para unir y abrir la pinza [37, 38] y para unir el ADN de la plantilla de cebador [39-41] (Figura 2). Sin embargo, la hidrólisis de ATP no es necesaria para la apertura de la pinza, que se cree que depende simplemente de la afinidad del cargador de pinza unido a ATP para la conformación abierta de la pinza: en el estado de ADP o vacío, el cargador de pinza tiene baja afinidad por la abrazadera [42, 43]. La actividad de la ATPasa del cargador de la pinza se estimula al unirse tanto a la pinza como al ADN [39, 40], y tras la hidrólisis de ATP, la afinidad del cargador de la pinza tanto para la pinza como para el ADN disminuye considerablemente, lo que provoca la expulsión de la pinza de el cargador de pinza.

Los cargadores de abrazaderas colocan abrazaderas deslizantes en las uniones cebador-plantilla para la replicación procesiva del ADN. Cuando se unen al ATP, los cargadores de pinzas son competentes para unir y abrir la proteína de la pinza deslizante. Este complejo ternario ahora puede unirse a una unión cebador-plantilla, que activa la actividad ATPasa del cargador de pinza. La hidrólisis de ATP hace que el cargador de la pinza se disocie de la pinza y el ADN, lo que da como resultado una pinza cargada que es competente para actuar como factor de procesividad para la ADN polimerasa. Figura adaptada de [60].

Este mecanismo complejo pero fundamental se materializa en un conjunto de composición sorprendentemente diversa, desde bacterias hasta eucariotas.


Volumen 2

66.3.5 Revisión de polimerasa

Las ADN polimerasas, que son enzimas de múltiples subunidades que incluyen Pol α, Pol δ y Pol ε, son críticas para la replicación precisa del ADN celular. 277 Mientras que Pol α inicia la síntesis de ADN, Pol δ y Pol ε realizan la mayor parte de la replicación del ADN con Pol δ sintetizando la hebra retrasada y Pol ε sintetizando la hebra principal. Dada la importancia de la replicación precisa del ADN, la función adecuada de estas enzimas es fundamental para mantener la estabilidad del ADN. Recientemente, se han descubierto mutaciones en las ADN polimerasas como un mecanismo para inducir inestabilidad genética, especialmente mutaciones que involucran las subunidades catalíticas y de corrección de pruebas de Pol δ y Pol ε, POLD1 y POLE, respectivamente. 278 Mutación de la línea germinal en POLO o POLD1 puede provocar poliposis colónica y un mayor riesgo de cáncer colorrectal y de endometrio. Esta predisposición al cáncer se hereda de forma autosómica dominante, y la poliposis asociada con estas mutaciones se ha denominado recientemente poliposis asociada a la corrección de la polimerasa (PPAP). 279 Los tumores que resultan de la disfunción de la corrección de pruebas de la ADN polimerasa suelen estar hipermutados, sin embargo, siguen siendo MSS.

Además de las mutaciones de la línea germinal en POLD1 y POLO, mutaciones somáticas en POLO también son importantes en el cáncer colorrectal esporádico. De hecho, recientemente se demostró que el 3% de los cánceres colorrectales tenían mutaciones en el dominio de exonucleasa de POLE. 92 Dado el reciente descubrimiento del papel de las ADN polimerasas en la carcinogénesis colorrectal, en este momento se desconoce si los defectos en estas polimerasas son importantes para la patogénesis de otros tipos de cáncer gastrointestinal.


Agradecimientos

Agradecemos a C. Kuhn, que obtuvo los primeros cristales de Pol I. Agradecemos a C. Bäjen, S. Benkert, S. Geiger, S. Jennebach, T. Gubbey y K. Maier. Agradecemos a la instalación de cristalización (Departamento de Conti) y al Departamento de Jentsch del Max-Planck-Institut de Bioquímica. Parte de este trabajo se realizó en la instalación europea de radiación sincrotrón en Grenoble, Francia, y en la fuente de luz suiza en el Paul-Scherrer-Institut, Villigen, Suiza. C.E. recibió el apoyo de una beca para estudiantes de doctorado del Boehringer Ingelheim Fonds, el programa Elite Network Bavaria "Protein Dynamics in Health and Disease" y la Graduate Research Academy "RNA Biology" de SFB960. S.S. recibió el apoyo de una beca postdoctoral de la Fundación Alexander-von-Humboldt. ORDENADOR PERSONAL. recibió el apoyo de Deutsche Forschungsgemeinschaft (SFB646, TR5, GraKo1721, SFB960, CIPSM, NIM), una subvención avanzada del Consejo Europeo de Investigación, Jung-Stiftung y la Fundación Vallee.


Contenido

Para los procariotas, cada nucleoide en división (región que contiene material genético que no es un núcleo) requiere dos replisomas para la replicación bidireccional. Los dos replisomas continúan la replicación en ambas bifurcaciones en el medio de la célula. Finalmente, a medida que se replica el sitio de terminación, los dos replisomas se separan del ADN. El replisoma permanece en una ubicación intermedia fija en la célula, adherido a la membrana, y la plantilla de ADN se enhebra a través de él. El ADN se alimenta a través del par estacionario de replisomas ubicados en la membrana celular.

Para los eucariotas, se forman numerosas burbujas de replicación en los orígenes de la replicación en todo el cromosoma. Al igual que con los procariotas, se requieren dos replisomas, uno en cada horquilla de replicación ubicada en el extremo de la burbuja de replicación. Debido a las diferencias significativas en el tamaño de los cromosomas y las complejidades asociadas de los cromosomas altamente condensados, varios aspectos del proceso de replicación del ADN en eucariotas, incluidas las fases terminales, están menos caracterizados que en los procariotas.

El replisoma es un sistema en el que varios factores trabajan juntos para resolver los desafíos estructurales y químicos de la replicación del ADN. El tamaño y la estructura de los cromosomas varían entre los organismos, pero dado que las moléculas de ADN son el depósito de información genética para todas las formas de vida, muchos desafíos y soluciones de replicación son los mismos para diferentes organismos. Como resultado, los factores de replicación que resuelven estos problemas están altamente conservados en términos de estructura, química, funcionalidad o secuencia. Los desafíos estructurales y químicos generales incluyen los siguientes:

  • Ensamblaje de replisoma eficiente en los orígenes de la replicación (complejos de reconocimiento de origen o secuencias de origen de replicación específicas en algunos organismos)
  • Separación del dúplex en las hebras de la plantilla anterior y posterior (helicasas)
  • Protección de las hebras anteriores y posteriores contra daños después de la separación dúplex (factores SSB y RPA)
  • Cebado de las hebras de plantilla principales y retrasadas (primasa o ADN polimerasa alfa)
  • Asegurar la procesividad (factores de carga de la abrazadera, proteínas de la abrazadera en forma de anillo, proteínas de unión a hebras)
  • Replicación de ADN de alta fidelidad (ADN polimerasa III, ADN polimerasa delta, ADN polimerasa épsilon. Todos tienen tasas de error intrínsecamente bajas debido a su estructura y química).
  • Corrección de errores (los sitios activos de la polimerasa replicativa detectan errores en los dominios de exonucleasa 3 'a 5' de las polimerasas replicativas corrigen errores)
  • Polimerización sincronizada de hebras iniciales y retrasadas a pesar de la estructura antiparalela (estructura de horquilla de replicación, dimerización de polimerasas replicativas)
  • Eliminación de cebadores (ADN polimerasa I, ARNasa H, endonucleasas de colgajo como FEN1 u otros factores de reparación del ADN)
  • Formación de enlaces fosfodiéster en los espacios entre los fragmentos de Okazaki (ligasa)

En general, los desafíos de la replicación del ADN involucran la estructura de las moléculas, la química de las moléculas y, desde una perspectiva de sistemas, las relaciones subyacentes entre la estructura y la química.

Muchos de los problemas estructurales y químicos asociados con la replicación del ADN son manejados por maquinaria molecular que está altamente conservada en todos los organismos. En esta sección se analiza cómo los factores replisomas resuelven los desafíos estructurales y químicos de la replicación del ADN.

Montaje replisome Editar

La replicación del ADN comienza en sitios llamados orígenes de replicación. En organismos con genomas pequeños y estructura cromosómica simple, como las bacterias, puede haber solo unos pocos orígenes de replicación en cada cromosoma. Los organismos con genomas grandes y estructura cromosómica compleja, como los humanos, pueden tener cientos, o incluso miles, de orígenes de replicación repartidos en múltiples cromosomas.

La estructura del ADN varía con el tiempo, el espacio y la secuencia, y se cree que estas variaciones, además de su papel en la expresión génica, también juegan un papel activo en el ensamblaje del replisoma durante la síntesis del ADN. El ensamblaje de replisome en un origen de replicación se divide aproximadamente en tres fases.

  • Formación de complejo de prerreplicación. DnaA se une al complejo de reconocimiento de origen y separa el dúplex. Esto atrae DnaB helicasa y DnaC, que mantienen la burbuja de replicación.
  • Formación de complejo de preiniciación. SSB se une a la hebra sencilla y luego gamma (factor de carga de sujeción) se une a SSB.
  • Formación del complejo de iniciación. Gamma deposita la abrazadera deslizante (beta) y atrae la ADN polimerasa III.
  • Formación de complejo de prerreplicación. Los factores MCM se unen al complejo de reconocimiento de origen y separan el dúplex, formando una burbuja de replicación.
  • Formación de complejo de preiniciación. La proteína de replicación A (RPA) se une al ADN monocatenario y luego el RFC (factor de carga de sujeción) se une al RPA.
  • Formación del complejo de iniciación. RFC deposita la abrazadera deslizante (PCNA) y atrae ADN polimerasas como alfa (α), delta (δ), épsilon (ε).

Tanto para los procariotas como para los eucariotas, la siguiente etapa se conoce generalmente como "elongación", y es durante esta fase cuando se produce la mayor parte de la síntesis de ADN.

Separación de la edición dúplex

El ADN es un dúplex formado por dos hebras antiparalelas. Siguiendo a Meselson-Stahl, el proceso de replicación del ADN es semiconservador, por lo que durante la replicación el dúplex de ADN original se separa en dos hebras hijas (denominadas plantillas de hebra delantera y rezagada). Cada hebra hija se convierte en parte de un nuevo dúplex de ADN. Los factores denominados genéricamente helicasas desenrollan el dúplex.

Helicases Editar

La helicasa es una enzima que rompe los enlaces de hidrógeno entre los pares de bases en el medio del dúplex de ADN. Su estructura en forma de rosquilla envuelve el ADN y separa las hebras antes de la síntesis de ADN. En eucariotas, el complejo Mcm2-7 actúa como una helicasa, aunque no está del todo claro qué subunidades son necesarias para la actividad helicasa. [2] Esta helicasa se transloca en la misma dirección que la ADN polimerasa (3 'a 5' con respecto a la hebra molde). En los organismos procariotas, las helicasas se identifican mejor e incluyen dnaB, que se mueve de 5 'a 3' en la hebra opuesta a la ADN polimerasa.

Desbobinado de superenrollamientos y decantación Editar

A medida que la helicasa desenrolla la doble hélice, los cambios topológicos inducidos por el movimiento de rotación de la helicasa conducen a la formación de una superenrollamiento por delante de la helicasa (similar a lo que sucede cuando se retuerce un trozo de hilo).

Girasa y topoisomerasas Editar

Gyrase (una forma de topoisomerasa) relaja y deshace el superenrollamiento causado por la helicasa. Lo hace cortando las hebras de ADN, lo que le permite rotar y liberar la superenrollamiento, y luego volver a unir las hebras.Gyrase se encuentra más comúnmente aguas arriba de la bifurcación de replicación, donde se forman las superenrollamientos.

Protección de las hebras anteriores y posteriores Editar

El ADN monocatenario es muy inestable y puede formar enlaces de hidrógeno consigo mismo, que se denominan "horquillas" (o la hebra sencilla puede unirse de forma inadecuada a la otra hebra sencilla). Para contrarrestar esta inestabilidad, proteínas de unión de una sola hebra (SSB en procariotas y proteína de replicación A en eucariotas) se unen a las bases expuestas para evitar una ligadura incorrecta.

Si considera cada hebra como una "cuerda dinámica y elástica", el potencial estructural de una ligadura inadecuada debería ser obvio.

La hebra rezagada sin proteínas de unión.
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Bases de hebras rezagadas =========================================== Esqueleto de fosfato de azúcar

Un esquema ampliado revela la química subyacente del problema: el potencial de formación de enlaces de hidrógeno entre pares de bases no relacionados.

Vista esquemática de cadenas de ADN recién separadas sin proteínas de unión a cadenas.
--HH -------- HH-HH - H - HH ---------- HH - HH - H Esquema de enlace de hidrógeno HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Esquema de enlace de hidrógeno HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Esquema de enlace de hidrógeno TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Bases de hebras rezagadas =========================================== Esqueleto de fosfato de azúcar

Las proteínas de unión estabilizan la hebra única y protegen la hebra del daño causado por reacciones químicas no autorizadas.

La hebra rezagada recubierta con proteínas de unión (*) que previenen la ligadura inadecuada.
******************************************* Proteínas de unión a hebras TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Bases de hebras rezagadas =========================================== Esqueleto de fosfato de azúcar

La combinación de una hebra única y sus proteínas de unión sirve como un mejor sustrato para las polimerasas replicativas que una hebra simple desnuda (las proteínas de unión proporcionan una fuerza impulsora termodinámica adicional para la reacción de polimerización). Las proteínas de unión a cadenas se eliminan mediante polimerasas replicativas.

Cebado de las hebras anteriores y posteriores Editar

Tanto desde una perspectiva estructural como química, una sola hebra de ADN por sí misma (y las proteínas de unión monocatenarias asociadas) no es adecuada para la polimerización. Esto se debe a que las reacciones químicas catalizadas por polimerasas replicativas requieren un 3 'OH libre para iniciar el alargamiento de la cadena de nucleótidos. En términos de estructura, la conformación de los sitios activos de la polimerasa replicativa (que está muy relacionada con la precisión inherente de las polimerasas replicativas) significa que estos factores no pueden iniciar el alargamiento de la cadena sin una cadena de nucleótidos preexistente, porque ninguna polimerasa replicativa conocida puede iniciar el alargamiento de la cadena. de novo.

Las enzimas cebadoras (que son polimerasas de ARN dependientes de ADN) resuelven este problema creando un cebador de ARN en las hebras principales y rezagadas. La hebra principal se ceba una vez y la hebra retrasada se ceba aproximadamente cada 1000 (+/- 200) pares de bases (un cebador por cada fragmento de Okazaki en la hebra retrasada). Cada cebador de ARN tiene aproximadamente 10 bases de largo.

Cadena única de ADN con proteínas de unión a cadena (*) y cebador de ARN añadido por enzimas de cebado (UAGCUAUAUAUA).
=========================================== Esqueleto de fosfato de azúcar ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Bases de hebras rezagadas UAGCUAUAUAUA ****************************** Proteínas de unión a cadenas y cebadores de ARN

La interfase en (A *) contiene un 3 'OH libre que es químicamente adecuado para la reacción catalizada por polimerasas replicativas, y la configuración "saliente" es estructuralmente adecuada para el alargamiento de cadena por una polimerasa replicativa. Por tanto, las polimerasas replicativas pueden comenzar el alargamiento de la cadena en (A *).

Primase Editar

En los procariotas, la primasa crea un cebador de ARN al comienzo de las cadenas principales y rezagadas recién separadas.

ADN polimerasa alfa Editar

En eucariotas, la ADN polimerasa alfa crea un cebador de ARN al comienzo de las cadenas principales y rezagadas recién separadas y, a diferencia de la primasa, la ADN polimerasa alfa también sintetiza una cadena corta de desoxinucleótidos después de crear el cebador.

Garantizar la procesividad y la sincronización Editar

La procesividad se refiere tanto a la velocidad como a la continuidad de la replicación del ADN, y una alta procesividad es un requisito para la replicación oportuna. La alta procesividad está asegurada en parte por proteínas en forma de anillo denominadas 'pinzas' que ayudan a que las polimerasas replicativas permanezcan asociadas con las cadenas principales y rezagadas. También hay otras variables: desde una perspectiva química, las proteínas de unión a cadenas estimulan la polimerización y proporcionan energía termodinámica adicional para la reacción. Desde la perspectiva de los sistemas, la estructura y la química de muchos factores replisoma (como las características AAA + ATPasa de las subunidades de carga de la abrazadera individuales, junto con la conformación helicoidal que adoptan) y las asociaciones entre los factores de carga de la abrazadera y otros factores accesorios, también aumenta la procesividad.

Hasta este punto, según la investigación de Kuriyan et al., [3] debido a su papel en el reclutamiento y unión de otros factores como las enzimas cebadoras y las polimerasas replicativas, los cargadores de pinzas y las pinzas deslizantes están en el corazón de la maquinaria replisoma. La investigación ha encontrado que la carga de la abrazadera y los factores de abrazadera deslizante son absolutamente esenciales para la replicación, lo que explica el alto grado de conservación estructural observado para la carga de la abrazadera y los factores de abrazadera deslizante. Esta conservación arquitectónica y estructural se ve en organismos tan diversos como bacterias, fagos, levaduras y humanos. El hecho de que se observe un grado tan significativo de conservación estructural sin homología de secuencia respalda aún más la importancia de estas soluciones estructurales para los desafíos de la replicación.

Cargador de pinzas Editar

Cargador de pinza es un término genérico que se refiere a factores de replicación llamados gamma (procariotas) o RFC (eucariotas). La combinación de ADN molde y ARN cebador se conoce como 'ADN en forma A' y se cree que las proteínas de replicación de carga de pinza (heteropentámeros helicoidales) quieren asociarse con el ADN en forma A debido a su forma (la estructura de la principal / surco menor) y química (patrones de donantes y aceptores de enlaces de hidrógeno). [3] [4] Por lo tanto, las proteínas de carga de la pinza se asocian con la región cebada de la hebra que causa la hidrólisis de ATP y proporciona energía para abrir la pinza y unirla a la hebra. [3] [4]

Abrazadera deslizante Editar

La abrazadera deslizante es un término genérico que se refiere a factores de replicación en forma de anillo llamados beta (procariotas) o PCNA (eucariotas). Las proteínas de sujeción atraen y anclan polimerasas replicativas, como la ADN polimerasa III, para extender la cantidad de tiempo que una polimerasa replicativa permanece asociada con la hebra. Desde una perspectiva química, la pinza tiene una carga ligeramente positiva en su centro que es una combinación casi perfecta para la carga ligeramente negativa de la cadena de ADN.

En algunos organismos, la pinza es un dímero y en otros organismos, la pinza es un trímero. Independientemente, la arquitectura de anillo conservada permite que la abrazadera encierre la hebra.

Dimerización de polimerasas replicativas Editar

Las polimerasas replicativas forman un dímero asimétrico en la horquilla de replicación al unirse a subunidades del factor de carga de la abrazadera. Esta conformación asimétrica es capaz de replicar simultáneamente las cadenas principales y atrasadas, y la colección de factores que incluye las polimerasas replicativas se denomina generalmente holoenzima. Sin embargo, siguen existiendo desafíos importantes: los capítulos principales y rezagados son antiparalelos. Esto significa que la síntesis de nucleótidos en la cadena principal ocurre naturalmente en la dirección 5 'a 3'. Sin embargo, la hebra retrasada corre en la dirección opuesta y esto presenta un gran desafío ya que ninguna polimerasa replicativa conocida puede sintetizar ADN en la dirección 3 'a 5'.

La dimerización de las polimerasas replicativas resuelve los problemas relacionados con la sincronización eficiente de la síntesis de cadenas principales y retrasadas en la bifurcación de replicación, pero el estrecho acoplamiento espacial-estructural de las polimerasas replicativas, al tiempo que resuelve el difícil problema de la sincronización, crea otro desafío: la dimerización de las polimerasas replicativas en la bifurcación de replicación significan que la síntesis de nucleótidos para ambas cadenas debe tener lugar en la misma ubicación espacial, a pesar del hecho de que la cadena rezagada debe sintetizarse hacia atrás en relación con la cadena principal. La síntesis de la hebra retrasada tiene lugar después de que la helicasa haya desenrollado una cantidad suficiente de la hebra retrasada, y esta "cantidad suficiente de la hebra retrasada" se polimeriza en cadenas de nucleótidos discretas denominadas fragmentos de Okazaki.

Considere lo siguiente: la helicasa desenrolla continuamente el dúplex parental, pero la hebra rezagada debe polimerizarse en la dirección opuesta. Esto significa que, mientras avanza la polimerización de la hebra delantera, la polimerización de la hebra retrasada sólo se produce después de que la helicasa haya desenrollado una cantidad suficiente de la hebra retrasada. En este punto, la polimerasa replicativa de la hebra retrasada se asocia con la pinza y el cebador para iniciar la polimerización. Durante la síntesis de la hebra rezagada, la polimerasa replicativa envía la hebra rezagada hacia la bifurcación de replicación. La polimerasa replicativa se disocia cuando alcanza un cebador de ARN. La helicasa continúa desenrollando el dúplex parental, la enzima cebadora fija otro cebador y la polimerasa replicativa se reasocia con la pinza y el cebador cuando se ha desenrollado una cantidad suficiente de la hebra rezagada.

En conjunto, la síntesis de las cadenas principales y retrasadas se denomina "semidiscontinua".

Replicación de ADN de alta fidelidad Editar

Los organismos procariotas y eucariotas usan una variedad de polimerasas replicativas, algunas de las cuales están bien caracterizadas:

ADN polimerasa III Editar

Esta polimerasa sintetiza la cadena de ADN principal y retrasada en procariotas.

ADN polimerasa delta Editar

Esta polimerasa sintetiza ADN de hebra rezagada en eucariotas. [5] (Se cree que forma un dímero asimétrico con la ADN polimerasa épsilon). [6]

ADN polimerasa épsilon Editar

Esta polimerasa sintetiza la cadena principal de ADN en eucariotas. [7] (Se cree que forma un dímero asimétrico con ADN polimerasa delta) [5]

Revisión de pruebas y corrección de errores Editar

Aunque es raro, se produce una polimerización de emparejamiento de bases incorrecta durante el alargamiento de la cadena. (La estructura y la química de las polimerasas replicativas significa que los errores son poco probables, pero ocurren). Muchas polimerasas replicativas contienen un mecanismo de "corrección de errores" en forma de un dominio de exonucleasa 3 'a 5' que es capaz de eliminar pares de bases de el extremo 3 'expuesto de la cadena de crecimiento. La corrección de errores es posible porque los errores de pares de bases distorsionan la posición de los iones magnesio en la subunidad de polimerización, y la distorsión químico-estructural de la unidad de polimerización detiene efectivamente el proceso de polimerización al ralentizar la reacción. [8] Posteriormente, la reacción química en la unidad de exonucleasa se hace cargo y elimina los nucleótidos del extremo 3 'expuesto de la cadena en crecimiento. [9] Una vez que se elimina un error, la estructura y la química de la unidad de polimerización vuelven a la normalidad y la replicación del ADN continúa. Trabajando colectivamente de esta manera, el sitio activo de polimerización puede considerarse como el "corrector de pruebas", ya que detecta los desajustes, y la exonucleasa es el "editor", ya que corrige los errores.

Los errores de pares de bases distorsionan el sitio activo de la polimerasa entre 4 y 6 nucleótidos, lo que significa que, según el tipo de desajuste, hay hasta seis posibilidades de corrección de errores. [8] Las características de detección y corrección de errores, combinadas con la precisión inherente que surge de la estructura y química de las polimerasas replicativas, contribuyen a una tasa de error de aproximadamente 1 par de bases de desajuste en 108 a 10 10 pares de bases.

Vista esquemática de los pares de bases correctos seguida de 8 posibles desajustes de pares de bases. [10]
=========================================== Esqueleto de fosfato de azúcar ATCG AGAC TTCG xxxxxxxxxxxxxxxxxxxxxxxxxxxx Bases de filamentos de revestimiento originales TAGC AGGC TCAT xxxxxxxxxxxxxxxxxxxxxxxxxxxx Bases correctamente emparejadas seguidas de 8 posibles desajustes =========================================== Esqueleto de fosfato de azúcar

Los errores se pueden clasificar en tres categorías: desajustes de purina-purina, desajustes de pirimidina-pirimidina y desajustes de pirimidina-purina. La química de cada desajuste varía, al igual que el comportamiento de la polimerasa replicativa con respecto a su actividad de detección de desajuste.

La replicación del ADN del bacteriófago T4 tras la infección de E. coli es un sistema de replicación de ADN bien estudiado. Durante el período de aumento exponencial del ADN a 37 ° C, la tasa de alargamiento es de 749 nucleótidos por segundo. [11] La tasa de mutación durante la replicación es de 1,7 mutaciones por 108 pares de bases. [12] Por lo tanto, la replicación del ADN en este sistema es muy rápida y muy precisa.

Eliminación de imprimación y ligadura de muescas Editar

Hay dos problemas después de la síntesis de la cadena principal y retrasada: el ARN permanece en el dúplex y hay mellas entre cada fragmento de Okazaki en el dúplex retrasado. Estos problemas se resuelven mediante una variedad de enzimas de reparación del ADN que varían según el organismo, que incluyen: ADN polimerasa I, ADN polimerasa beta, ARNasa H, ligasa y ADN2. Este proceso está bien caracterizado en procariotas y mucho menos bien caracterizado en muchos eucariotas.

En general, las enzimas de reparación del ADN completan los fragmentos de Okazaki a través de una variedad de medios, que incluyen: escisión de pares de bases y actividad exonucleasa 5 'a 3' que elimina los ribonucleótidos químicamente inestables del dúplex rezagado y los reemplaza con desoxinucleótidos estables. Este proceso se conoce como "maduración de fragmentos de Okazaki", y la ligasa (ver más abajo) completa el paso final en el proceso de maduración.

Dúplex de ARN-ADN con ribonucleótidos añadidos por una enzima cebadora (-) y desoxinucleótidos añadidos por una polimerasa replicativa (+).
=========================================== Esqueleto de fosfato de azúcar ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Bases de filamentos de revestimiento originales UAGCUAUAUAUACGTCGATCTTCGAATTTATATACGATCGTAC Con el cebador, las bases recién sintetizadas son una combinación de uracilo, adenina, timina, citosina y guanina. =========================================== Con la imprimación, la columna vertebral de fosfato de azúcar está hecha de ribosa y desoxirribosa. ------------+++++++++++++++++++++++++++++++ - indica ribonucleótido y + indica desoxinucleótido

La eliminación del cebador y la ligadura de muescas se pueden considerar como procesos de reparación del ADN que producen un dúplex libre de errores y químicamente estable. En este punto, con respecto a la química de un dúplex ARN-ADN, además de la presencia de uracilo en el dúplex, la presencia de ribosa (que tiene un 2 'OH reactivo) tiende a hacer que el dúplex sea mucho menos estable químicamente. que un dúplex que contiene solo desoxirribosa (que tiene un 2 'H no reactivo).

ADN polimerasa I Editar

La ADN polimerasa I es una enzima que repara el ADN.

RNAsa H Editar

La ARNasa H es una enzima que elimina el ARN de un dúplex ARN-ADN.

Ligase Editar

Después de que los factores de reparación del ADN reemplazan los ribonucleótidos del cebador con desoxinucleótidos, queda un solo espacio en el esqueleto de azúcar-fosfato entre cada fragmento de Okazaki en el dúplex rezagado. Una enzima llamada ADN ligasa conecta el espacio en la columna vertebral formando un enlace fosfodiéster entre cada espacio que separa los fragmentos de Okazaki. Los aspectos estructurales y químicos de este proceso, generalmente denominado "traducción de muescas", exceden el alcance de este artículo.

A continuación se muestra una vista esquemática del nuevo dúplex de ADN hijo de la hebra rezagada, junto con el esqueleto de azúcar-fosfato.
=========================================== Cadena principal de desoxirribosa-fosfato de hebra retrasada original ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Bases de filamentos de revestimiento originales TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Después de la actividad del factor de reparación del ADN, las bases son adenina, timina, citosina y guanina. ========|=============|============|======= Después de la actividad del factor de reparación del ADN, la columna vertebral es desoxirribosa-fosfato pura con muescas entre cada fragmento de Okazaki.
El dúplex terminado:
=========================================== Cadena principal de desoxirribosa-fosfato de hebra retrasada original ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Bases de filamentos de revestimiento originales TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Bases recién sintetizadas =========================================== Esqueleto de desoxirribosa-fosfato recién sintetizado sin fragmentos de Okazaki.

El estrés de replicación puede provocar una bifurcación de replicación detenida. Un tipo de estrés replicativo resulta del daño del ADN, como los enlaces cruzados entre cadenas (ICL). Una ICL puede bloquear la progresión de la horquilla replicativa debido a una falla en la separación de la hebra de ADN. En las células de vertebrados, la replicación de una plantilla de cromatina que contiene ICL desencadena el reclutamiento de más de 90 factores de reparación del ADN y mantenimiento del genoma. [13] Estos factores incluyen proteínas que realizan incisiones secuenciales y recombinación homóloga.

Katherine Lemon y Alan Grossman mostraron usando Bacillus subtilis que los replisomas no se mueven como trenes a lo largo de una vía, sino que el ADN en realidad se alimenta a través de un par de replisomas estacionarios ubicados en la membrana celular. En su experimento, los replisomas en B. subtilis se marcaron cada uno con proteína verde fluorescente, y se controló la ubicación del complejo en las células en replicación usando microscopía de fluorescencia. Si los replisomas se movieran como un tren en una vía, la proteína polimerasa-GFP se encontraría en diferentes posiciones en cada célula. En cambio, sin embargo, en cada célula en replicación, los replisomas se observaron como focos fluorescentes distintos ubicados en o cerca de la célula media. El ADN celular teñido con un tinte azul fluorescente (DAPI) ocupaba claramente la mayor parte del espacio citoplásmico. [14]


¿La ARN polimerasa se mueve alrededor del ADN o el ADN rota debajo de la polimerasa? - biología

El complejo promotor abierto (OC) es un intermedio central durante el inicio de la transcripción que contiene una burbuja de ADN. Aquí, empleamos experimentos de transferencia de energía de resonancia de Förster de una sola molécula y análisis del sistema de nanoposicionamiento para determinar la arquitectura tridimensional de un OC mínimo que consta de ADN promotor, incluida una caja TATA y una región no coincidente de 11 nucleótidos alrededor del sitio de inicio de la transcripción. , Proteína de unión a caja TATA (TBP), ARN polimerasa (Pol) II y factor de transcripción general (TF) IIB y TFIIF. En este OC mínimo, TATA-DNA y TBP residen por encima de la hendidura Pol II entre los dominios de clamp y protrusión. El ADN corriente abajo se carga y descarga dinámicamente de la hendidura Pol II en una escala de tiempo de segundos. El dominio central de TFIIB se desplaza de la pared Pol II, donde se encuentra en el complejo promotor cerrado. Estos resultados revelan grandes cambios estructurales generales durante la transición de iniciación-elongación, que aparentemente son acomodados por la flexibilidad intrínseca de TFIIB.

Reflejos

► ADN promotor aguas arriba y TBP por encima de la hendidura en el complejo promotor abierto Pol II ► Reordenamiento importante de ADN, TBP y TFIIB aguas arriba durante la transición abierta-cerrada ► ADN aguas abajo en complejo abierto cambiando dinámicamente entre dos conformaciones

Dirección actual: Departamento de Física, Universidad de Ulm, Albert-Einstein-Allee 11, 89081 Ulm, Alemania


Replicación del ADN: definición, mecanismo y modelos | Bioquímica

En este artículo discutiremos sobre: ​​- 1.Definición de replicación del ADN 2. Enzimas involucradas en la replicación del ADN 3. Mecanismo 4. Modelos 5. Modelo de Watson y Crick & # 8217s.

  1. Definición de replicación del ADN
  2. Enzimas involucradas en la replicación del ADN
  3. Mecanismo de replicación del ADN
  4. Modelos para la replicación del ADN
  5. Modelo de Watson y Crick & # 8217s para la replicación del ADN

1. Definición de replicación del ADN:

Una de las propiedades más importantes del ADN es que forma sus copias idénticas adicionales. El proceso de formación de su copia réplica se llama replicación. La replicación es la base de la evolución de todas las formas de vida morfológicamente complejas.

Howard y Pelc (1953) demostraron que en eucariotas la replicación ocurre durante la interfase entre los ciclos mitóticos y también durante la interfase de la meiosis. Durante la interfase de la división celular, el número de moléculas de ADN se duplica, lo que en la anafase se separa en dos células hijas y, por lo tanto, se mantiene el mismo número de cromosomas.

Sin embargo, la replicación no ocurre durante toda la anafase, sino que se limita solo a la fase de síntesis (vS). Existe una brecha posmitótica (G1) entre la telofase y la fase S. Un segundo espacio premitótico (G2) se encuentra entre la fase S y la profase. Solo la fase S implica un proceso de replicación.

La fase Gl es más variable y en muchas células eucariotas se completa en 3 a 4 horas o incluso meses, dependiendo de las condiciones fisiológicas. La mayor parte de la síntesis de ADN se logra en 7 a 8 horas. En las bacterias que crecen en fase logarítmica, la síntesis de ADN se produce desde el momento en que se origina una célula para dar lugar a dos células hijas. Es de destacar que las bacterias se dividen solo a través de la fisión binaria.

En general, el ADN realiza dos funciones importantes como la función heterocatalítica y la función autocatalítica. La función heterocatalítica es la síntesis de proteínas dirigida por el ADN y la función autocatalítica es la síntesis de su propio ADN en copias de réplica. Sin embargo, la replicación del ADN en procariotas difiere de la de eucariotas.

2. Enzimas involucradas en la replicación del ADN:

Tanto las células procariotas como las eucariotas contienen tres tipos de enzimas nucleares que son esenciales para la replicación del ADN. Estas enzimas son nucleasas, polimerasas y ligasas.

(i) Nucleasas:

El polinucleótido se mantiene unido mediante enlaces fosfodiéster. Las nucleasas hidrolizan la cadena de polinucleótidos en nucleótidos. Ataca en el extremo 3 & # 8242 OH o en el extremo 5 & # 8242 fosfato de la cadena. Las nucleasas son de dos tipos (Fig. 5.17-B).

La nucleasa que ataca el extremo libre exterior de la cadena de polinucleótidos se llama exonucleasa. Rompe el enlace fosfodiéster en la dirección (A) o en la dirección 3 & # 8217 → 5 & # 8242 (B). La enzima se mueve en ambos casos paso a paso a lo largo de la cadena y elimina los nucleótidos uno por uno. Por tanto, se digiere toda la cadena.

Las endonucleasas atacan dentro de la porción interna de una o las hebras dobles. Por lo tanto, se hace una muesca en una molécula de ADN de doble hebra. Sin embargo, si la cadena polipeptídica es monocatenaria (por ejemplo, en virus de ADN), el ataque de la endonucleasa convertirá la cadena en dos partes.

En el ADN de doble hebra, la muesca contiene dos extremos libres que, a su vez, actúan como molde para la replicación del ADN. Aparte de esto, la doble hélice mellada se distorsiona debido a la rotación de moléculas libres alrededor de su hebra intacta.

(ii) ADN polimerasas:

Las ADN polimerasas llevan a cabo el proceso de polimerización de nucleótidos y formación de cadena polinucleotídica. Esta enzima se llama replicasa cuando replica las moléculas de ADN y las heredan las células hijas. En 1959, A. Romberg descubrió por primera vez una enzima en E. coli que polimerizó el desoxirribonucleótido trifosfato en una plantilla de ADN y produjo una hebra complementaria de ADN.

Esta enzima se llamó ADN polimerasa. Más tarde fue nombrada como polimerasa de Komberg o enzima de Romberg por el nombre del descubridor, para demostrar la polimerización in vitro del ADN. Para la catálisis de la polimerización, se requieren los cuatro desoxirribonucleótidos trifosfatos, p. Ej. dATP, dGTP, dTTP y dCTP, una plantilla de ADN, un cebador para el inicio de la actividad catalítica y Mg ++ (Fig. 5.18).

En procariotas, tres tipos de ADN polimerasas, p. Ej. polimerasa I (Poly-I), polimerasa II (Pol II) y ADN polimerasa III (Pol III), mientras que en eucariotas se encuentran tres o cuatro polimerasas denominadas α, β y ү polimerasas y ADN polimerasa de mitocondrias (mt) .

El peso molecular de las polimerasas α y ү es superior a 100.000 y el de la polimerasa β es de 30.000-50.000. Las polimerasas α y β se encuentran en el núcleo. La β-polimerasa copia una plantilla poli (A) o poli (C). La ү-polimerasa copia muchos polirribonucleótidos como poli (A), poli (C), etc. La polimerasa de ADNmt es como la ү-polimerasa.

La polimerasa de Kornberg se conoce como Pol I. Es una cadena peptídica única con un peso molecular de 109.000 D. Es la cadena única más grande de proteína globular conocida hasta ahora. Está presente un átomo de zinc (Zn) por cadena, por lo tanto, es metaloenzina. En E. coli, están presentes aproximadamente 400 moléculas de Pol I.

Los primeros experimentos llevados a cabo por Kornberg revelaron que cuando se sintetizaron artificialmente cadenas de plantilla de ADN alternando A y T, es decir, poli d (AT), se incubaron con polimerasa y cuatro nucleósidos trifosfato radiomarcados, se sintetizó DN A radiactivo que contenía A y T alternas.

Aunque estaba presente una cantidad suficiente de dGTP y dCTP en la solución, estos no se sintetizaron en ADN porque la hebra de ADN contenía solo poli dAT. Esto enfatiza que Pol I sintetiza solo una copia complementaria de la plantilla.

La forma de Pol I se ha estudiado mediante microscopio electrónico. Es aproximadamente esférico de unos 65 A de diámetro (Fig. 5.18) que se une regularmente a la cadena de ADN.

Pol I posee varios sitios de archivos adjuntos como:

(i) Un sitio de plantilla para la unión a la plantilla de ADN,

(ii) Un sitio de cebador de aproximadamente 100 nucleótidos contemporáneo a un segmento de ARN en el que ocurre el crecimiento de ADN recién sintetizado,

(iii) Un sitio de terminación del cebador que contiene un grupo 3 & # 8217OH terminal en la punta, y

(iv) Un sitio de trifosfato para emparejar los nucleósidos trifosfatos entrantes de acuerdo con el nucleótido complementario de la plantilla de ADN.

Pol I juega un papel importante en el proceso de polimerización (sintético) así como de degradación (exonucleolítico) de nucleótidos, Pol I se rompe con tripsina en dos fragmentos, un fragmento grande (PM 75.000) y un fragmento pequeño (PM 36.000). El fragmento grande muestra actividad exonucleasa 3 & # 8242 → 5 & # 8242, y el fragmento pequeño muestra actividad exonucleasa 5 & # 8242 → 3 & # 8242. En E. coli se han encontrado los siguientes tres tipos de funciones de Pol I.

La polimerización es un proceso de síntesis en la dirección 5 & # 8242 → 3 & # 8242 de segmentos cortos de la cadena de ADN desde los monómeros de desoxirribonucleósido trifosfato hasta el extremo 3 & # 8242 -OH de una cadena de ADN. No es la principal enzima de polimerización porque no puede sintetizar una cadena larga. Sintetiza solo un pequeño segmento de ADN.

Se une solo a un ADN y forma una muesca en el ADN de doble cadena. Por tanto, participa en la síntesis reparadora. En E. coli Pol I polimerizo los nucleótidos a una velocidad de 1.000 nucleótidos por minuto a 37 ° C. La principal enzima asociada con la polimerización se conoce como polimerasa III.

Actividad exonucleasa:

Actividad de exonucleasa 3 ’→ 5 & # 8242:

Pol I cataliza la ruptura de una o dos hebras de ADN en la dirección 3 '→ 5 & # 8242 en los componentes de nucleótidos, es decir, los nucleótidos se liberan en la dirección 3 & # 8242 → 5 & # 8242 que es inversa a la dirección de polimerización.

Por lo tanto, se denomina actividad exonucleasa 3 & # 8242 → 5 & # 8242. Pol I corrijo los errores cometidos durante la polimerización y edita los nucleótidos que no coinciden en el extremo del cebador antes del inicio de la síntesis de la hebra. Por lo tanto, la función de Pol I se denomina síntesis de reparación.

5 & ​​# 8242 → 3 & # 8242 actividad exonucleasa:

Pol I también rompe la cadena de polinucleótidos en la dirección 5 & # 8242 → 3 & # 8242 con la eliminación de residuos de nucleótidos. Tras la exposición del ADN a la luz ultravioleta, dos pirimidinas adyacentes, como las timinas, se unen covalentemente formando dímeros de pirimidina. Estos dímeros bloquean la replicación del ADN. Por tanto, la eliminación de los dímeros de pirimidina, p. Los dímeros de timina (T = T) son necesarios.

A través de la actividad exonucleasa 5 & # 8242 → 3 & # 8242, Pol I elimina los dímeros de pirimidina. En segundo lugar, la síntesis de ADN se produce en el cebador de ARN en forma de fragmentos de Okazaki. A través de 5 & # 8242 → 3 & # 8242 actividad exonucleasa Pol, elimino el cebador de ARN y selle el espacio con desoxirribonucleótidos. Su movimiento hacia adelante da como resultado la eliminación de ribonucleótidos de la parte frontal seguida de desoxirribonucleótidos detrás de ella.

(b) Polimerasa II (Pol II):

Durante varios años, se consideró que Pol I era responsable de la replicación en E. coli. pero el trabajo realizado durante la década de 1970 dejó en claro que Pol I está asociado solo con la síntesis de reparación y las otras enzimas, Pol II y Pol III están involucradas en el proceso de polimerización. Pol II es una cadena polipeptídica simple (PM 90.000) que muestra la polimerización en la dirección 5 '→ 3' de una cadena complementaria.

También muestra actividad exonucleasa en la dirección 3 '→ 5' pero no en la dirección 5 '→ 3'. La actividad de polimerización de Pol II es mucho menor que Pol I en células de E. coli. Se sintetizan aproximadamente 50 nucleótidos por minuto. Las células de E. coli contienen alrededor de 40 moléculas de Pol II.

La actividad exonucleasa 3 & # 8242 → 5 & # 8242 de Pol II muestra que también juega un papel en la síntesis de reparación o el ADN dañado por U.V. luz como Pol I. En ausencia de Pol I, puede alargar los fragmentos de Okazaki. Por tanto, Pol II es una alternativa a Pol I.

(c) Polimerasa III (Pol III):

La ADN polimerasa III es varias veces más activa que las enzimas Pol I y Pol II. Es el dímero de dos cadenas polipeptídicas con un peso molecular de 1.40.000 y 40.000 D respectivamente. Pol III polimeriza desoxirribonucleósidos trifosfatos en la dirección de manera muy eficiente. Por lo tanto, Pol III es la principal enzima de polimerización que puede polimerizar aproximadamente 15.000 nucleótidos por minuto en E. coll.

Al igual que Pol II, no puede polimerizar de manera eficiente si el ADN molde es demasiado largo, pero puede hacerlo cuando están presentes ATP y ciertos factores proteicos. La síntesis de una plantilla larga también ocurre cuando un ADN de proteína auxiliar (copolimerasa II) se une con Pol III y produce el complejo Pol III-co Pol II. Además, Pol III también muestra actividad de exonucleasa 3 & # 8217 → 5 & # 8242 como Pol II.

La actividad de exonucleasa 5 & # 8217 → 3 & # 8242 está ausente. Todas las polimerasas, p. Ej. Pol I, Pol II y Pol III muestran actividad exonucleasa 3 & # 8217 → 5 & # 8242, mientras que además de Pol I, las otras dos polimerasas (Pol I y Pol II) carecen de actividad exonucleasa 5 & # 8217 → 3 & # 8242. Sin embargo, algunos trabajadores han mostrado actividad exonucleasa 3 & # 8217 → 5 & # 8242 y 5 & # 8217 → 3 & # 8242 en Pol III.

(iii) ADN ligasas:

Las ligasas de ADN sellan las muescas de una sola hebra en el ADN que tiene 5 & # 8217 → 3 & # 8242 ter & shymini. Cataliza la formación de enlaces fosfodiéster entre 3 & # 8242-OH y 5 & # 8242-PO4 grupo de una muesca, y se convierte en un ADN intacto. Hay dos tipos de ADN ligasas: ADN ligasa de E. coli y ADN ligasa T4. La ADN ligasa de E. coli requiere nicotina y dinucleótido de adenina shymide (NAD +) como cofactor, mientras que la ADN ligasa T4 usa ATP como cofactor para la reacción de unión de la mella (Fig. 5.19).

3. Mecanismo de replicación del ADN:

A. Romberg (1992) ha discutido muy bien la replicación del ADN. En E. coli, la replicación del ADN se ha investigado más extensamente. Se pensaba que en eucariotas probablemente opera un mecanismo similar. Sin embargo, se ha encontrado que en E. coli la replicación siempre comienza en un sitio muy singular llamado origen. En E. coli, el aparato de replicación del dado contiene un complejo enzimático en el punto donde se une el hilo de ADN.

A través de este punto de replicación, el hilo de ADN se mueve y se logra la replicación. En eucariotas, la enzima se mueve a lo largo del hilo del ADN. Se ha descrito anteriormente que E. coli posee tres tipos de ADN polimerasas, cada una de las cuales lee la plantilla de ADN en la dirección 3 '→ 5' y cataliza la síntesis de ADN en la dirección 5 '→ 3'.

Las polimerasas leen desoxirribonucleótidos trifosfatos (dATP, dGTP, dCTP, dTTP) como sustrato y una plantilla de ADN.

Al extremo 3 & # 8242 del punto de crecimiento, los nucleótidos se agregan después de la interacción del extremo 3 & # 8242-OH de la desoxirribosa con el grupo alfa (primer) fosfato del sustrato que libera pirofosfato como se muestra a continuación:

Antes de que comience la replicación, la doble hélice del ADN debe desenrollarse para dar lugar a una sola hebra. El proceso de desenrollado ocurre muy rápidamente para formar una horquilla que gira alrededor de 75 l (X) revoluciones por segundo. El proceso de desenrollado es facilitado por helicasas.

En la tabla 5.7 se dan algunos genes y proteínas importantes asociados con la replicación:

La replicación general del ADN se logra en las siguientes etapas (Fig. 5.20):

(i) Desenrollamiento de doble hélice:

Las helicasas son responsables del desenrollado de la doble hélice. Usan energía de ATP para desenrollar tramos cortos de hélice justo delante de la bifurcación de replicación. Después de la separación de la hebra, es muy necesario mantenerlas monocatenarias a través de proteínas de unión a ADN (SSB) monocatenarias. El SSB es un tetrámero con cada una de las cuatro subunidades de un peso molecular de 18.500 & # 8211 22.000 Dalton.

Puede unirse como sitios de unión de 8-10 nucleótidos (fig. 5.20). Sin embargo, existe la posibilidad de que la tensión conduzca y la formación de súper bobinas en hélice.

El alivio de la tensión y la promoción del proceso de desenrollado se realizan mediante las enzimas topoisomerasas que rompen transitoriamente una de las dos hebras de tal manera que permanece sin cambios. Ata o desata un nudo en una hebra de ADN. La ADN girasa es una de las topoisomerasas de E. coli que elimina el súper enrollamiento del ADN durante la replicación. Por tanto, se forma una plantilla de ssDNA.

(ii) Replicación del ADN:

La replicación del ADN se logra en varios pasos. El primer paso es la síntesis del cebador de ARN en la plantilla de ADN cerca del origen de replicación. La síntesis del cebador de ARN es muy necesaria porque durante la replicación del ADN existe la posibilidad de que se produzcan más errores en la colocación inicial de los primeros nucleótidos en la plantilla de ADN preexistente. El ADN Pol I y Pol II no pueden sintetizar ADN sin un cebador de ARN, por lo tanto, una ARN polimerasa especial llamada primasa sintetiza un cebador corto de aproximadamente 10 nucleótidos de largo.

Antes del cebado, se forma el intermedio precebador con la ayuda de seis proteínas de cebado previo, p. proteínas dnaB, dnaC, n, n & # 8217, n & # 8221 e i. Para la síntesis del cebador, la primasa necesita varias proteínas accesorias que se combinan con la primasa. El complejo de primasa-proteína accesoria se denomina primosoma. Por lo tanto, la holoenzima de ADN Pol III comienza la síntesis de ADN en la dirección 5 & # 8217 → 3 & # 8242 al final del cebador de ARN (Fig. 5.20B).

El segundo paso es el alargamiento de la cadena. Una nueva cadena de ADN comienza a sintetizarse mediante la adición de trifosfatos de desoxirribonucieósido al extremo 3 & # 8242 del último nucleótido del cebador de ARN. La síntesis de ADN ocurre en la dirección 5 & # 8217 → 3 & # 8242 catalizada por el replisoma. El replisoma tiene dos complejos de holoenzimas de ADN Pol III. Es un complejo muy grande que contiene ADN Pol III y varias proteínas.

Las subunidades ү y β unen la holoenzima a la plantilla de ADN y al cebador. La subunidad a sintetiza el ADN. Una polimerasa copia continuamente la hebra principal (es decir, una hebra que crece en la dirección de la bifurcación de replicación y muestra una replicación continua).

La hebra rezagada (es decir, una hebra que crece en la dirección opuesta a la horquilla de replicación y que muestra una replicación discontinua de la hebra) gira alrededor del replisoma continuamente. Se forma una horquilla de replicación en forma de Y en el punto donde se separan dos hebras.

En la cadena principal, la síntesis de ADN se produce de forma continua porque siempre hay un 3 & # 8242-OH libre en la bifurcación de replicación a la que se añade un nuevo nucleótido. Pero en la hebra opuesta llamada hebra retrasada, la síntesis de ADN se produce de forma discontinua porque no hay 3 & # 8242 -OH en la bifurcación de replicación a la que se puede unir un nuevo nucleótido. En esta hebra hay 3 & # 8242 -OH libre en el extremo opuesto lejos del punto de crecimiento. Por lo tanto, en la hebra rezagada se debe sintetizar un cebador de ARN pequeño (de 11 bases de longitud) mediante primasa para proporcionar un grupo 3 & # 8242-OH libre.

La replicación del ADN tiene dos direcciones, una dirección (replicación unidireccional) y ambas direcciones (replicación bidireccional) desde el punto de origen. La replicación bidireccional se encuentra en la mayoría de las bacterias (por ejemplo, E. coli. Bacillus subtilis. Salmonella typhimurium, etc.), mientras que la replicación unidireccional ocurre en los bacteriófagos de E. coli (P2 y 186) y mtDNA de células LD de ratón.

Finalmente, se sintetizan aproximadamente un fragmento de 1000-2000 nucleótidos de largo en bacterias y un fragmento de aproximadamente 100 nucleótidos de largo en células eucariotas. Estos fragmentos se denominan fragmentos de Okazaki por el nombre de un descubridor japonés, R. Okazaki (fig. 5.20 B).

(iii) Eliminación del cebador de ARN y finalización de la hebra de ADN:

Cuando se forman los fragmentos de Okazaki, la mayoría de las hebras rezagadas se duplican. El cebador de ARN es eliminado por ADN Pol I o ARNasa H. La ADN polimerasa I sintetiza un segmento corto de ADN complementario para sellar el espacio. Posiblemente Pol I elimine el nucleótido cebador a la vez y lo reemplace con desoxirribonucleótido complementario adecuado (Fig. 5.20)

Fig. 5.20: Replicación del ADN en bacterias (diagrama) A. proceso general de replicación del ADN B. acción del replisoma, helicasas y primosoma, y ​​bucle de la hebra rezagada alrededor de la polimerasa III C, combinación de fragmentos de Okazaki, liberación de la hebra rezagada y sellado del brecha por ADN ligasa.

(iv) Unión de fragmentos:

Al final, los fragmentos se unen mediante ADN ligasa que forma un enlace fosfodiéster entre el extremo 3 & # 8242-OH de la hebra en crecimiento y el extremo 5 'de un fragmento de Okazaki (Fig. 5.20 C). La reacción de las ADN ligasas se muestra en la figura 5.19. En mutantes se produce ligasa defectuosa, por lo tanto, la unión de fragmentos de Okazaki se mejora enormemente.

La ADN ligasa de E. coli deriva energía de NAD. Primero es adenilado por la fracción AMP de NAD que libera el mononucleótido de nicotinamida (NMN). La ligasa adenilada reacciona con el ssDNA que tiene una muesca y forma un enlace fosfodiéster.

La reacción completa es la siguiente:

E. coli ligasa + NAD → ligasa & # 8211 AMP + NMN

Ligasa & # 8211 AMP + ADN (con rotura) → fosfodiéster + ligasa + AMP

Evidentemente, la replicación del ADN es un proceso muy complejo. Si se comete algún error durante la replicación, se producirá una mutación. E. coli comete un error de aproximadamente 10 -6 por gen por generación. El ADN Pol I y Pol III actúan como correctores de pruebas del ADN recién formado.

Estos se mueven a lo largo del nuevo ADN sintetizado, leen los errores formados debido a un emparejamiento inadecuado de bases y los corrigen mediante la actividad exonucleasa. A pesar de toda esta complejidad, la replicación tiene lugar rápidamente en bacterias (750-1.000 pares de bases por segundo) y mucho más lenta en eucariotas (50-100 pares de bases por segundo).

4. Modelos de replicación del ADN:

El patrón de replicación del ADN en procariotas difiere del de eucariotas. Estas diferencias se deben a la naturaleza del ADN procariótico. Por ejemplo, el ADN circular de E. coli se replica en un punto de replicación, el origen.En otros, el mecanismo es diferente.

Algunos de los modelos para la replicación del ADN se analizan a continuación:

(i) El modelo de Cairns para la replicación del ADN:

J. Caims (1963) fue el primero en visualizar el cromosoma replicante de E. coli mediante un estudio autoradiográfico. Este estudio reveló que el hilo de ADN en replicación se fijó en un sitio específico llamado origen y se movía en una dirección y dentro de una bifurcación de replicación donde se sintetizan las cadenas originales (Fig. 5.21).

Estudios posteriores han demostrado que en el ADN circular (Fig. 5.22A) las dos hebras se desnaturalizan en el sitio de origen (B). Hay síntesis de ADN bidireccional, es decir, después de la iniciación, aparecieron dos puntos de crecimiento que viajaban en direcciones opuestas alrededor de la molécula de ADN circular (C). Los puntos de crecimiento y timidez proceden con el desenrollado de la doble hélice del ADN.

El proceso de desenrollado crea un par de torsión que se transmite a la parte no replicada de la molécula de ADN, lo que da como resultado la formación de una súper hélice o una súper torsión (D). Super coil evita su posterior replicación. Una proteína giratoria (w) hace un corte temporal en una de las hebras que contrae este efecto.

El nick permite que la hebra parental gire libremente entre sí y finalmente se libere. Al final, la proteína giratoria sella la muesca para continuar el proceso de replicación (E). El proceso de replicación continúa y los dos puntos de crecimiento convergen en el terminal (F).

(ii) El modelo del círculo rodante:

Gilbert y Dressier (1969) describieron el modelo de círculo rodante para explicar la reactivación en virus ssDNA, p. Ej. Ø × 174 y la transferencia del factor sexual de E. coli.

(iii) Replicación en cromosoma eucariota:

La replicación del ADN en el cromosoma eucariótico no se comprende bien en comparación con el cromosoma procariótico. Sin embargo, el modelo bien aceptado para la replicación del ADN eucariota es el modelo bidireccional (fig. 5.23).

La síntesis de ADN comienza en un punto medio de la unidad de replicación que se llama punto de iniciación (origen O) (Fig. 5.23 A-B), y progresa en ambas direcciones hasta alcanzar el punto terminal (T) (C). La horquilla de replicación se encuentra en el punto T (D) en todo el cromosoma. Puede haber miles de puntos de iniciación.

5. Modelo de Watson y Crick & # 8217s para la replicación del ADN:

Cada cadena de doble hélice actúa como molde y evoluciona en la replicación del ADN. Watson y Crick propusieron que los enlaces de hidrógeno entre los pares de bases de dos hebras se rompen y se separan entre sí.

Cada base de purina y pirimidina de las hebras forma enlaces de hidrógeno con nucleótidos libres complementarios para participar en la polimerización en la célula. Los nucleótidos libres forman enlaces fosfodiéster con el residuo de desoxirribosa, lo que da como resultado la formación de una nueva molécula de polinucleótido (fig. 5.15). Este modelo de Watson y Crick para la replicación del ADN se verificó posteriormente de forma experimental.


Evidencia experimental para Watson y Crick & # 8217s Model for DNA Replication:

M. Meselson y F. Stahl (1958) proporcionaron el apoyo experimental para el modelo de Watson y Crick & # 8217s para la naturaleza semiconservadora de la replicación del ADN que se llama experimento de Meselson-Stahl. Cultivaron células de E. coli en un medio que contenía nitrógeno isotópico pesado (15 N) durante varias generaciones.

Obtuvieron una población de E. coli que contenía un total de 15 ADN marcado con N & # 8211. La densidad se midió mediante centrifugación en gradiente de densidad en CsCl que contenía bromuro de etidio. La densidad del ADN 15 N era más pesada (1,722 g / cc) que la del ADN normal (1,708 g / cc). De nuevo, las células de E. coli se cultivaron en un medio que contenía nitrógeno isotópico menos denso (14 N) y se dejaron multiplicar varias veces.

Después de la primera generación, se extrajo el ADN que resultó ser un híbrido de 15 N-14 N (Fig. 5.16). Esta hebra es 15 N y la otra 14 N. No era ni más pesada que 15 N ni más liviana que 14 N. En las células de la primera generación, 50% 14 N & # 8211 ADN, y 50% híbrido (15 N & # 8211 14 N) Se registró el ADN. En la segunda generación, la proporción de moléculas de ADN normales e híbridas fue de 3: 1.

Esta fue la naturaleza semiconservadora de la replicación del ADN porque en la primera generación una de las hebras parentales se convierte en progenie y la otra hebra polinucleotídica complementaria se replica. Por lo tanto, las dos hebras fueron los híbridos.

Se puede postular un modo conservador de replicación del ADN, es decir, ambas cadenas de ADN originales actúan como molde para un nuevo dúplex pero no se separan y dan como resultado una doble hélice antigua y nueva en la primera generación. No se forma ADN-15 N & # 8211 14 N híbrido. Por lo tanto, este modelo no pudo ser apoyado por el experimento de Meselson-Stahl.

Además, este experimento no es compatible con el modo dispersivo de replicación del ADN en cuyo modelo no existe un patrón de replicación. Las hebras parentales se rompen al azar en varios puntos durante la replicación. Cada segmento se replicará y volverá a unirse al azar.

Esto da como resultado una cantidad variable de moléculas de ADN nuevas y antiguas en las células hijas. Después de la primera generación, en lugar de un solo híbrido 15 N-14 N, se detecta un amplio espectro de densidades de ADN. Por lo tanto, el modo dispersivo de replicación también se descarta mediante el experimento de Meselson y Stahl.


Papel biológico

Los agentes endógenos y ambientales modifican continuamente el ADN genómico, lo que da como resultado daños físicos o modificaciones que dan como resultado niveles en estado estacionario de 50000 & # x02014200000 sitios apurínicos / apirimidínicos (AP) por célula eucariota. 4 sitios AP se generan a través de la depurinación espontánea o la hidrólisis enzimática específica de la lesión del norte-glucosilo enlace entre la desoxirribosa y la base. Se ha estimado que la tasa de depurinación espontánea es & # x0223c10 4 depurinaciones por célula por día. 5 La vía de reparación por escisión de la base (BER) (Figura & # x200B (Figura 1) 1) es responsable de eliminar las lesiones de la base simple y los sitios AP en el ADN. Pol & # x003b2 contribuye con dos actividades enzimáticas, la síntesis de ADN y la desoxirribosa fosfato (dRP) liasa, durante la reparación de los sitios AP.

Reparación de escisión de base. La reparación por escisión de la base implica la eliminación de un nucleótido dañado (punteros rojos) del ADN. Se reemplaza con un nucleótido no dañado (punteros verdes). La base dañada se elimina mediante una ADN glicosilasa específica para el daño (1) que hidroliza el enlace N-glicosídico entre la desoxirribosa y la base dañada. En esta imagen, el uracilo sería eliminado por la uracilo ADN glicosilasa. La endonucleasa AP 1 hace una incisión en el esqueleto de azúcar y fosfato 5 y # x02032 en el sitio AP (2). El dominio liasa de pol & # x003b2 (3) elimina el grupo 5 & # x02032-dRP (puntero rojo) y el dominio polimerasa inserta un nucleótido en una reacción dependiente de la plantilla (puntero verde). La ADN ligasa (4) sella el ADN cortado, lo que da como resultado la restauración de la estructura original del ADN.

Los sitios AP representan lesiones potencialmente peligrosas porque pueden ser mutagénicas y citotóxicas. La endonucleasa 1 AP hace una incisión en el sitio AP, dando como resultado los extremos 3 & # x02032-hidroxilo y 5 & # x02032-dRP. El grupo dRP es escindido por la actividad liasa de pol & # x003b2, dando como resultado un 5 & # x02032-fosfato y un hueco de un nucleótido (es decir, una base de plantilla única). Pol & # x003b2 llena este espacio de un solo nucleótido, lo que da como resultado un ADN cortado que posteriormente se ligará para restaurar la estructura nativa del ADN & # x02019.

Como se analiza en detalle a continuación y en otros lugares, 6,7 pol & # x003b2 y otros miembros de la familia X de ADN polimerasas han evolucionado para llenar breves brechas de ADN durante transacciones celulares esenciales. En un sistema de modelo de ratón, la pérdida de pol & # x003b2 da como resultado la letalidad embrionaria; sin embargo, los fibroblastos de ratón embrionarios cultivados son viables. 8 Estas células son hipersensibles a los tóxicos genómicos debido a la acumulación de intermediarios de reparación citotóxicos. 9 Además de sus actividades enzimáticas, pol & # x003b2 interactúa físicamente con otros factores BER clave que aceleran la reparación en los sitios AP. 10

El papel fundamental que desempeña pol & # x003b2 en la BER y la síntesis de ADN que llena los huecos de alta fidelidad implica a pol & # x003b2 y BER como supresores de tumores. 11,12 Congruente con esta idea es la observación de que un alto porcentaje de tumores tienen variantes de pol & # x003b2. Estos a menudo tienen actividades catalíticas o de fidelidad alteradas y pueden inducir la transformación celular. 13 Muchas de estas variantes tienen cambios de aminoácidos distantes de los sitios activos de la polimerasa o liasa. Queda por ver si estas alteraciones afectan las interacciones de proteínas críticas y proteínas necesarias para una BER eficiente o el comportamiento dinámico de proteínas críticas que influye en la actividad catalítica y / o la fidelidad (ver más abajo).


Contenido

En la década de 1970, James C. Wang fue el primero en descubrir una topoisomerasa cuando identificó E. coli topoisomerasa I. Los códigos CE topográficos son los siguientes: Independiente de ATP (tipo I), CE 5.6.2.1 Dependencia de ATP (Tipo II): CE 5.6.2.2.

La función general de la ADN topoisomerasa es controlar el estado topológico del ADN en la célula. Hay dos tipos o familias de esta familia de enzimas tipo I y familia de tipo II. La familia de tipo I pasa una hebra del ADN a través de una ruptura en la hebra opuesta. En otras palabras, la enzima ADN topoisomerasa tipo I escinde solo una hebra de ADN. La familia de tipo II pasa una región de dúplex (dos hebras) de la misma molécula o una molécula diferente a través de un espacio de doble hebra. En resumen, el tipo II escinde ambas cadenas de ADN, lo que da como resultado una ruptura de doble cadena. Las topoisomerasas pueden aliviar las superenrollamientos negativos, tanto positivos como negativos, o inducir el superenrollamiento positivo y negativo en el ADN. Las enzimas también pueden promover la catenación (cuando dos cadenas de ADN circulares simples se unen entre sí después de la replicación) y la decantación (la separación de dos cromosomas circulares, cerrados y unidos), y también pueden aliviar el entrelazamiento de cromosomas lineales. [2]

La configuración de doble hélice de las cadenas de ADN hace que sea difícil separarlas, lo cual es requerido por las enzimas helicasa si otras enzimas deben transcribir las secuencias que codifican proteínas o si los cromosomas deben replicarse. En el ADN circular, en el que el ADN de doble hélice se dobla y se une en un círculo, las dos hebras están topológicamente unidas o anudadas. De lo contrario, los bucles de ADN idénticos, que tienen diferentes números de torsiones, son topoisómeros y no se pueden interconvertir sin romper las hebras de ADN. Las topoisomerasas catalizan y guían el desanudamiento o desvinculación del ADN [3] mediante la creación de rupturas transitorias en el ADN utilizando una tirosina conservada como residuo catalítico. [1]

La inserción de ADN (viral) en los cromosomas y otras formas de recombinación también pueden requerir la acción de las topoisomerasas.

Las moléculas circulares topológicamente unidas, también conocidas como catenanos, adoptan una forma superenrollada positiva durante el proceso de replicación de los plásmidos circulares. La desvinculación de los catenanos se realiza mediante topoisomerasas de tipo IIA, que recientemente se descubrió que son más eficientes en la desvinculación del ADN superenrollado positivo. Las propiedades conformacionales de los catenanos superenrollados negativos frente a los positivos afectan sus características con respecto a su correspondiente reacción enzimática catalizada por topoisomerasas. Los experimentos han demostrado que el ADN superenrollado positivo proporciona una curva pronunciada del ADN en el primer segmento de ADN unido, lo que permite que la topoisomerasa se una con éxito y, por lo tanto, lleve a cabo su reacción enzimática con el siguiente segmento en una materia específica de adentro hacia afuera. Por otro lado, el ADN superenrollado negativo no proporciona tal curvatura y el acceso de la enzima al primer segmento es casi imposible, por lo que inhibe la desvinculación. [4]

La topoisomerasa también se encuentra en las mitocondrias de las células. [5] Las mitocondrias generan ATP y juegan un papel en la muerte celular programada y el envejecimiento. [6] El ADN mitocondrial de las células animales es un ADN circular de doble hebra que requiere la actividad de la topoisomerasa para ser replicado. Las clases de topoisomerasa que se encuentran en las mitocondrias son I, IIβ, IIIα. [5]

Levadura Editar

Se sabe que las células de levadura utilizan tres topoisomerasas: la topoisomerasa I, de la subfamilia IB, es necesaria para el crecimiento. Proporciona a la bifurcación de replicación la capacidad de avanzar, además de eliminar las superenrollamientos positivos y negativos asociados con la transcripción. La topoisomerasa II de la subfamilia IIA es necesaria para la decantación de los cromosomas enlazados y la preparación para la segregación durante la mitosis. La topoisomerasa II no puede inducir superenrollamientos negativos, pero puede relajar los superenrollamientos positivos y negativos como la topoisomerasa I, y puede reemplazar a la topoisomerasa I si está ausente. La topoisomerasa III de la familia IA se usa para el crecimiento celular. Sin la topoisomerasa III, las tasas de recombinación en la mitosis y la meiosis pueden aumentar, lo que ralentiza el crecimiento de las células. En S. pombe células, III se utiliza para mantener la división celular.

Eucariotas superiores Editar

Los organismos eucariotas superiores son organismos más complejos y normalmente requieren una maquinaria celular más compleja. Estos organismos generalmente tienen una topoisomerasa I, dos topoisomerasas de tipo IIA y dos enzimas de tipo III. La topoisomerasa I ayuda con el movimiento de la horquilla de replicación y relaja las superenrollamientos asociados con la transcripción. También se utiliza para relajar las superenrollamientos solenoidales que se forman cuando los cromosomas se condensan en preparación para la mitosis. Las dos topoisomerasas de tipo IIA, IIα y IIβ, se utilizan para desvincular los dúplex hijos entrelazados, así como para ayudar en la división celular y la supresión de la recombinación, respectivamente. Se cree que los tipos IIIα y IIIβ funcionan en la embriogénesis e interactúan con las helicasas, respectivamente.

Eubacterias Editar

E. coli contiene cuatro ADN topoisomerasas: dos enzimas de tipo IA (I y III) y dos de tipo IIA (ADN girasa y topoisomerasa IV). La ADN topoisomerasa III y IV tienen funciones similares. La topoisomerasa III es incapaz de relajar las superenrollamientos positivos, pero funciona para apoyar el movimiento de la horquilla de replicación en el ADN plasmídico. in vitro. Puede desencadenar el devanado que está sucediendo detrás de la bifurcación de replicación al enfocarse en las muescas en el ADN. La topoisomerasa IV es la enzima decatenizante más eficaz en E. coli. También relaja los superenrollamientos negativos. La ADN girasa utiliza la hidrólisis de ATP para generar un superenrollamiento negativo en los cromosomas bacterianos. Relaja las superenrollamientos positivos antes de la horquilla de replicación y actúa en la condensación cromosómica. Finalmente, la topoisomerasa I ayuda a generar algo de superenrollamiento negativo junto con la topoisomerasa IV y la ADN girasa.

Archaea Editar

Existe un conocimiento limitado sobre las secuencias del genoma de las arqueas. Por lo tanto, también existe un conocimiento limitado sobre las enzimas topoisomerasas. Contienen una girasa inversa, una topoisomerasa de tipo IA y una topoisomerasa VI. Las funciones de las topoisomerasas en arqueas son comparables a las enzimas en eubacterias. La única diferencia digna de mención es que la topoisomerasa VI en las arqueas es responsable de la decantación de los intermediarios de replicación del ADN, y relaja los superenrollamientos positivos y negativos.

Bacteriófago Editar

El bacteriófago (fago) T4 girasa (topoismerasa de tipo II) es una proteína de múltiples subunidades que consta de los productos de los genes 39, 52 y probablemente 60. Cataliza la relajación del ADN superhélice negativa o positiva y se emplea en la replicación del ADN del fago durante la infección del E. coli huésped bacteriano. Dado que el anfitrión E. coli La ADN girasa puede compensar parcialmente la pérdida de los productos génicos del fago T4; los mutantes defectuosos en los genes 39, 52 o 60 no anulan completamente la replicación del ADN del fago, sino que retrasan su inicio. [7] Los mutantes defectuosos en los genes 39, 52 o 60 muestran un aumento de la recombinación genética, así como un aumento de la sustitución de bases y la mutación por deleción, lo que sugiere que la síntesis de ADN compensada por el huésped es menos precisa que la dirigida por el fago de tipo salvaje. [8] Los mutantes defectuosos en los genes 39, 52 y 60 también tienen una capacidad reducida para llevar a cabo la reactivación de la multiplicidad, una forma de reparación recombinacional que puede hacer frente a diferentes tipos de daños en el ADN. [9]

La topología del ADN son las conformaciones terciarias del ADN, como el superenrollamiento, el anudado y la catenación. La topología del ADN puede verse alterada por la mayoría de los procesos metabólicos: la ARN polimerasa puede causar superenrollamientos positivos al enrollar en exceso el ADN frente a la enzima, y ​​también puede causar superenrollamientos negativos al enrollar el ADN detrás de la enzima. La ADN polimerasa tiene el mismo efecto en la replicación del ADN. El superenrollamiento positivo y negativo equilibra toda la topología global del ADN, por lo que, en general, la topología sigue siendo la misma. Sin embargo, a medida que avanza la horquilla de replicación o transcripción del ADN y aumenta el superenrollamiento positivo, las hebras de ADN se envuelven cada vez más apretadas entre sí, lo que dificulta que la polimerasa avance. Es importante que se alivie la topología local del ADN por delante y por detrás de la polimerasa para que puedan continuar la replicación y la división celular. Para esto se utilizan las ADN topoisomerasas. [10]

Problemas topológicos Editar

Hay tres tipos principales de topología:

Fuera de los procesos esenciales de replicación o transcripción, el ADN debe mantenerse lo más compacto posible, y estos tres estados ayudan a esta causa. Sin embargo, cuando se produce la transcripción o la replicación, el ADN debe estar libre y estos estados dificultan seriamente los procesos. Además, durante la replicación, el dúplex de ADN recién replicado y el dúplex de ADN original se entrelazan y deben separarse por completo para garantizar la integridad genómica a medida que la célula se divide. A medida que avanza una burbuja de transcripción, el ADN delante de la bifurcación de transcripción se sobreenrolla, o positivamente superenrollado, mientras que el ADN detrás de la burbuja de transcripción se vuelve subbobinado o negativamente superenrollado. A medida que ocurre la replicación, el ADN por delante de la burbuja de replicación se vuelve positivamente superenrollado, mientras que el ADN detrás de la horquilla de replicación se enreda formando precatenanes. Uno de los problemas topológicos más esenciales ocurre al final de la replicación, cuando los cromosomas hijos deben desenredarse por completo antes de que ocurra la mitosis. La topoisomerasa IIA juega un papel esencial en la resolución de estos problemas topológicos.

Muchos fármacos actúan a través de la interferencia con las topoisomerasas [11]. Los antibióticos fluoroquinolonas de amplio espectro actúan alterando la función de las topoisomerasas bacterianas de tipo II. Estos inhibidores de moléculas pequeñas actúan como agentes antibacterianos eficientes al secuestrar la capacidad natural de la topoisomerasa para crear roturas en el ADN cromosómico.

Algunos medicamentos de quimioterapia llamados inhibidores de la topoisomerasa funcionan interfiriendo con las topoisomerasas eucariotas de tipo mamífero en las células cancerosas. Esto induce roturas en el ADN que finalmente conducen a la muerte celular programada (apoptosis). Este efecto dañino del ADN, fuera de sus posibles propiedades curativas, puede conducir a neoplasias secundarias en el paciente. [ cita necesaria ]

La topoisomerasa I es el antígeno reconocido por los anticuerpos Anti Scl-70 en la esclerodermia.

Las topoisomerasas pueden solucionar estos problemas topológicos y se separan en dos tipos según el número de hebras cortadas en una ronda de acción: [12] Ambas clases de enzimas utilizan una tirosina conservada. Sin embargo, estas enzimas son estructural y mecánicamente diferentes. Para ver un video de este proceso, haga clic aquí.


Datos extendidos Fig. 1 Mapa de densidad electrónica de rNaMTP o rNaM.

a, El mapa de densidad de electrones omitidos de 2Fo-Fc no sesgado de rNaMTP está contorneado a 1,2 σ. B, El mapa de densidad de electrones omitidos de 2Fo-Fc no sesgado de rNaM está contorneado a 1,2 σ.

Datos extendidos Fig. 2 La estabilidad relativa de los NTP para mantener una buena geometría de activación se representa como una función del tiempo total de simulación.

La estabilidad relativa se define como la estabilidad de los NTP en comparación con rNaMTP para mantener una buena geometría de activación, -ln (pNTP/pagrNaMTP), en unidad de energía (RT). pagNTP y PrNaMTP son el porcentaje de tramas con buena activación en simulaciones NTP y rNaMTP, respectivamente. Los criterios para una buena geometría de activación son 3.0 Å ≤ distancia entre O3 ′ - Pα ≤ 3.5 Å y 7.0 Å ≤ distancia de pares de bases (rNaMTP, ATP o GTP) ≤ 9.0 Å, 6.0 Å ≤ distancia de pares de bases (CTP, UTP) ≤ 8.0 UNA. El gráfico muestra que la simulación ha convergido ya que el orden de estabilidad entre los NTP sigue siendo el mismo independientemente del tiempo de simulación. Es importante destacar que el rNaMTP es de hecho el sustrato más estable cuando dTPT3 es el ADN molde. Los datos se muestran como valores medios ± desviación estándar, que se calcularon mediante bootstrapping de N simulaciones MD de producción independientes (N = 4, 8, 12, 16 para los datos en el punto de tiempo de 200, 400, 600, 800 ns en el x -eje, respectivamente).

Datos extendidos Fig. 3 Simulación MD de ATP y rTPT3TP en el sitio A a través de dNaM (con Mg2 + ion A y amp Mg2 + ion B).

Simulación MD de ATP y rTPT3TP en el sitio A a través de dNaM (con ion A de Mg 2+ y ion de amp Mg 2+ B). (a y B) Panel izquierdo: diagrama de mapa de calor bidimensional de la geometría de emparejamiento base. La distancia del par de bases es la distancia entre el centro de masa de dNaM y los NTP. Observamos una fuerte localización de los fotogramas de simulación en el par dNaM-rTPT3TP, mientras que el ATP estaba muy disperso tanto en distancia como en ángulo. Panel derecho: distancia del ataque nucleofílico. Se traza la distribución de los cuadros de simulación ordenados por la distancia entre Pα del NTP entrante y O3 'del ARN terminal. Una buena geometría de activación (3,0 Å ≤ distancia entre O3´-Pα ≤ 3,5 Å y 6,0 Å ≤ distancia de pares de bases ≤ 8,0 Å) se indica con líneas de puntos rojos. El porcentaje de marcos de simulación con conformación catalíticamente activa se mostró como valores medios ± desviación estándar, que se calcularon mediante bootstrapping de N simulaciones MD de producción independiente (N = 16).

Datos extendidos La Fig. 4 La estructura de UBP de la ADN polimerasa (dNaM-d5SICSTP, PDB 3SV3) muestra una configuración coplanar de borde a borde.

La estructura de UBP de la ADN polimerasa (dNaM-d5SICSTP, PDB 3SV3) muestra una configuración coplanar de borde a borde.


Ver el vídeo: 05 01 DNA polimerasa (Enero 2022).